Gene Name | Type | Activity (log2) in S2 cells (avg/min/max) |
Cluster | Data available | ||||
---|---|---|---|---|---|---|---|---|
S2 | Kc167 | BG3 | OSC | HeLa | ||||
CG33785 (FBgn0061362) | cofactor |
|
Additional information
H. sapiens orthologues1
POLR3K (HGNC:14121, ENSG00000161980)
Functionally similar transcription factors and cofactors
CDS DNA Sequence2
ATGTTGTTTTTCTGCCCGTCGTGCGGAAATATATTGATTATCGAGGAGGACACCAACTGCCATCGCTTCACGTGCAACACCTGCCCGTACATATCGAAGATCAGGCGCAAGATCTCCACGAAAACCTTTCCACGCCTCAAGGAGGTGGATCACGTGCTGGGCGGCAAGGCGGCGTGGGAGAACGTAGACTCCACGGACGCAGAGTGTCCAACGTGCGGCCATAAGCGGGCGTACTTTATGCAAATCCAGACGCGGTCGGCGGATGAGCCCATGACCACGTTTTACAAGTGCTGCAACCACGAGTGCAACAACACCTGGCGAGAC
CDS AA Sequence2
MLFFCPSCGNILIIEEDTNCHRFTCNTCPYISKIRRKISTKTFPRLKEVDHVLGGKAAWENVDSTDAECPTCGHKRAYFMQIQTRSADEPMTTFYKCCNHECNNTWRD
1 H. sapiens orthologs were obtained from InParanoid8, in particular D.melanogaster-H.sapiens.orthoXML.
2 Genomic sequences of the transcription factors were obtained from the dm3/BDGP Release 5 genome assembly. In the case of cofactors, the genomic sequences stand for our results obtained by deep sequencing.
2 Genomic sequences of the transcription factors were obtained from the dm3/BDGP Release 5 genome assembly. In the case of cofactors, the genomic sequences stand for our results obtained by deep sequencing.