Gene Name | Type | Activity (log2) in S2 cells (avg/min/max) |
Cluster | Data available | ||||
---|---|---|---|---|---|---|---|---|
S2 | Kc167 | BG3 | OSC | HeLa | ||||
CG6272 (FBgn0036126) | TF |
|
Additional information
H. sapiens orthologues1
CEBPG (HGNC:1837, ENSG00000153879)
Functionally similar transcription factors and cofactors
CDS DNA Sequence2
ATGCCGGCCAAAAAGAGAACTGCCGCGTCGACCAGCAAAAATAGCGATTCGCCATTAAGTCCGCACACAGACGATCCAGCGTACAAAGAAAAAAGAAAGAAAAACAATGAGGCTGTTCAGCGCACACGCGAAAAGACCAAGAAATCGGCCGAGGAACGTAAGAAACGCATCGATGATTTGAGGAAGCAAAACGATGCTCTTAAGGTTCAGATCGAGACGAGTGAAAAACATATATCTACGCTTAGAGATCTGATCATTCAGGGTGAGAAAACGGAGGACGGCCATCGAATCATCCAGGAGATTCTCGCTGAACCAGATCCCGATCCCAAGGACAATGAC
CDS AA Sequence2
MPAKKRTAASTSKNSDSPLSPHTDDPAYKEKRKKNNEAVQRTREKTKKSAEERKKRIDDLRKQNDALKVQIETSEKHISTLRDLIIQGEKTEDGHRIIQEILAEPDPDPKDND
1 H. sapiens orthologs were obtained from InParanoid8, in particular D.melanogaster-H.sapiens.orthoXML.
2 Genomic sequences of the transcription factors were obtained from the dm3/BDGP Release 5 genome assembly. In the case of cofactors, the genomic sequences stand for our results obtained by deep sequencing.
2 Genomic sequences of the transcription factors were obtained from the dm3/BDGP Release 5 genome assembly. In the case of cofactors, the genomic sequences stand for our results obtained by deep sequencing.